
AAAGCTCGGTTATAACCATCATTTTCCGAAGACCAGCTACAGCTCACTGCAATTT
Gene expression technology is used to evaluate changes in genes being visualised in normal and transformed cells. Changes in tens of thousands of genes can be evaluated at once. Every color represents a different kind of change to a cell. It's all about measuring energy and classifying structures, f.e. to eventually be able to mutate our building blocks into their NEXT NATURE.
Picked Articles ...
Loading stories...

Comments (0)
Share your thoughts and join the technology debate!
No comments yet
Be the first to share your thoughts!