20k human chip

20k human chip

20k human chip


AAAGCTCGGTTATAACCATCATTTTCCGAAGACCAGCTACAGCTCACTGCAATTT

Gene expression technology is used to evaluate changes in genes being visualised in normal and transformed cells. Changes in tens of thousands of genes can be evaluated at once. Every color represents a different kind of change to a cell. It's all about measuring energy and classifying structures, f.e. to eventually be able to mutate our building blocks into their NEXT NATURE.


cell scanning

Picked Articles ...
Loading stories...

Comments (0)

Share your thoughts and join the technology debate!

No comments yet

Be the first to share your thoughts!